Antibodies
Anti-CPSF73 Antibody-Oligo Conjugate
SKU: aoc1739
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-CPSF73 Antibody-PLA1
Antibody Target
- Target
- Cleavage and polyadenylation specificity factor subunit 3
- UniProt Number
- Q9UKF6
- Target Description
- Component of the cleavage and polyadenylation specificity factor (CPSF) complex that plays a key role in pre-mRNA 3'-end formation, recognizing the AAUAAA signal sequence and interacting with poly(A) polymerase and other factors to bring about cleavage and poly(A) addition. Has endonuclease activity, and functions as an mRNA 3'-end-processing endonuclease (PubMed:30507380). Also involved in the histone 3'-end pre-mRNA processing (PubMed:30507380). U7 snRNP-dependent protein that induces both the 3'-endoribonucleolytic cleavage of histone pre-mRNAs and acts as a 5' to 3' exonuclease for degrading the subsequent downstream cleavage product (DCP) of mature histone mRNAs. Cleavage occurs after the 5'-ACCCA-3' sequence in the histone pre-mRNA leaving a 3'hydroxyl group on the upstream fragment containing the stem loop (SL) and 5' phosphate on the downstream cleavage product (DCP) starting with CU nucleotides. The U7-dependent 5' to 3' exonuclease activity is processive and degrades the DCP RNA substrate even after complete removal of the U7-binding site. Binds to the downstream cleavage product (DCP) of histone pre-mRNAs and the cleaved DCP RNA substrate in a U7 snRNP dependent manner. Required for entering/progressing through S-phase of the cell cycle (PubMed:30507380). Required for the selective processing of microRNAs (miRNAs) during embryonic stem cell differentiation via its interaction with ISY1 (By similarity). Required for the biogenesis of all miRNAs from the pri-miR-17-92 primary transcript except miR-92a (By similarity). Only required for the biogenesis of miR-290 and miR-96 from the pri-miR-290-295 and pri-miR-96-183 primary transcripts, respectively (By similarity)..
- Molecular Weight
- 77kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC2567
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat