Antibodies
Anti-CRBN Antibody-Oligo Conjugate
SKU: aoc1743
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CRBN Antibody-IF1
Antibody Target
- Target
- Protein cereblon
- UniProt Number
- Q96SW2
- Target Description
- Substrate recognition component of a DCX (DDB1-CUL4-X-box) E3 protein ligase complex that mediates the ubiquitination and subsequent proteasomal degradation of target proteins, such as MEIS2, ILF2 or GLUL (PubMed:26990986, PubMed:33009960). Normal degradation of key regulatory proteins is required for normal limb outgrowth and expression of the fibroblast growth factor FGF8 (PubMed:20223979, PubMed:24328678, PubMed:25043012, PubMed:25108355). Maintains presynaptic glutamate release and consequently cognitive functions, such as memory and learning, by negatively regulating large-conductance calcium-activated potassium (BK) channels in excitatory neurons (PubMed:18414909, PubMed:29530986). Likely to function by regulating the assembly and neuronal surface expression of BK channels via its interaction with KCNT1 (PubMed:18414909). May also be involved in regulating anxiety-like behaviors via a BK channel-independent mechanism (By similarity). Plays a negative role in TLR4 signaling by interacting with TRAF6 and ECSIT, leading to inhibition of ECSIT ubiquitination, an important step of the signaling (PubMed:31620128)..
- Molecular Weight
- 51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC64184
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat