Antibodies
Anti-CRBN Antibody-Oligo Conjugate
SKU: aoc1743
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CRBN Antibody-IF1
Antibody Target
- Target
- Protein cereblon
- UniProt Number
- Q96SW2
- Target Description
- Substrate recognition component of a DCX (DDB1-CUL4-X-box) E3 protein ligase complex that mediates the ubiquitination and subsequent proteasomal degradation of target proteins, such as MEIS2, ILF2 or GLUL. Normal degradation of key regulatory proteins is required for normal limb outgrowth and expression of the fibroblast growth factor FGF8. Maintains presynaptic glutamate release and consequently cognitive functions, such as memory and learning, by negatively regulating large-conductance calcium-activated potassium (BK) channels in excitatory neurons. Likely to function by regulating the assembly and neuronal surface expression of BK channels via its interaction with KCNT1. May also be involved in regulating anxiety-like behaviors via a BK channel-independent mechanism. Plays a negative role in TLR4 signaling by interacting with TRAF6 and ECSIT, leading to inhibition of ECSIT ubiquitination, an important step of the signaling.
- Molecular Weight
- 51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC64184
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat