Antibodies
Anti-Creatine kinase B type (CKB) Antibody-Oligo Conjugate
SKU: aoc1745
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Creatine kinase B type (CKB) Antibody-IF1
Antibody Target
- Target
- Creatine kinase B-type
- UniProt Number
- P12277
- Target Description
- Reversibly catalyzes the transfer of phosphate between ATP and various phosphogens (e.g. creatine phosphate). Creatine kinase isoenzymes play a central role in energy transduction in tissues with large, fluctuating energy demands, such as skeletal muscle, heart, brain and spermatozoa (Probable). Acts as a key regulator of adaptive thermogenesis as part of the futile creatine cycle: localizes to the mitochondria of thermogenic fat cells and acts by mediating phosphorylation of creatine to initiate a futile cycle of creatine phosphorylation and dephosphorylation. During the futile creatine cycle, creatine and N-phosphocreatine are in a futile cycle, which dissipates the high energy charge of N-phosphocreatine as heat without performing any mechanical or chemical work.
- Molecular Weight
- 43kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1990
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat