Antibodies
Anti-CREB3L2 Antibody-Oligo Conjugate
SKU: aoc1748
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CREB3L2 Antibody-IF1
Antibody Target
- Target
- Cyclic AMP-responsive element-binding protein 3-like protein 2
- UniProt Number
- Q70SY1
- Target Description
- Transcription factor involved in unfolded protein response (UPR). In the absence of endoplasmic reticulum (ER) stress, inserted into ER membranes, with N-terminal DNA-binding and transcription activation domains oriented toward the cytosolic face of the membrane. In response to ER stress, transported to the Golgi, where it is cleaved in a site-specific manner by resident proteases S1P/MBTPS1 and S2P/MBTPS2. The released N-terminal cytosolic domain is translocated to the nucleus to effect transcription of specific target genes. Plays a critical role in chondrogenesis by activating the transcription of SEC23A, which promotes the transport and secretion of cartilage matrix proteins, and possibly that of ER biogenesis-related genes (By similarity). In a neuroblastoma cell line, protects cells from ER stress-induced death (PubMed:17178827). In vitro activates transcription of target genes via direct binding to the CRE site (PubMed:17178827)..
- Molecular Weight
- 57 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC63997
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat