Antibodies
Anti-CRM1 Antibody-Oligo Conjugate
SKU: aoc1750
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CRM1 Antibody-IF1
Antibody Target
- Target
- Exportin-1
- UniProt Number
- O14980
- Target Description
- Mediates the nuclear export of cellular proteins (cargos) bearing a leucine-rich nuclear export signal (NES) and of RNAs. In the nucleus, in association with RANBP3, binds cooperatively to the NES on its target protein and to the GTPase RAN in its active GTP-bound form (Ran-GTP). Docking of this complex to the nuclear pore complex (NPC) is mediated through binding to nucleoporins. Upon transit of a nuclear export complex into the cytoplasm, disassembling of the complex and hydrolysis of Ran-GTP to Ran-GDP (induced by RANBP1 and RANGAP1, respectively) cause release of the cargo from the export receptor. The directionality of nuclear export is thought to be conferred by an asymmetric distribution of the GTP- and GDP-bound forms of Ran between the cytoplasm and nucleus. Involved in U3 snoRNA transport from Cajal bodies to nucleoli. Binds to late precursor U3 snoRNA bearing a TMG cap..; FUNCTION: (Microbial infection) Mediates the export of unspliced or incompletely spliced RNAs out of the nucleus from different viruses including HIV-1, HTLV-1 and influenza A. Interacts with, and mediates the nuclear export of HIV-1 Rev and HTLV-1 Rex proteins. Involved in HTLV-1 Rex multimerization..
- Molecular Weight
- 123kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0104
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat