Antibodies
Anti-CSK Antibody-Oligo Conjugate
SKU: aoc1758
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CSK Antibody-IF1
Antibody Target
- Target
- Tyrosine-protein kinase CSK
- UniProt Number
- P41240
- Target Description
- Non-receptor tyrosine-protein kinase that plays an important role in the regulation of cell growth, differentiation, migration and immune response. Phosphorylates tyrosine residues located in the C-terminal tails of Src-family kinases (SFKs) including LCK, SRC, HCK, FYN, LYN, CSK or YES1. Upon tail phosphorylation, Src-family members engage in intramolecular interactions between the phosphotyrosine tail and the SH2 domain that result in an inactive conformation. To inhibit SFKs, CSK is recruited to the plasma membrane via binding to transmembrane proteins or adapter proteins located near the plasma membrane. Suppresses signaling by various surface receptors, including T-cell receptor (TCR) and B-cell receptor (BCR) by phosphorylating and maintaining inactive several positive effectors such as FYN or LCK.
- Molecular Weight
- 51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1835
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat