Antibodies
Anti-CUL3 Antibody-Oligo Conjugate
SKU: aoc1765
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CUL3 Antibody-IF1
Antibody Target
- Target
- Cullin-3
- UniProt Number
- Q13618
- Target Description
- Core component of multiple cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complexes which mediate the ubiquitination and subsequent proteasomal degradation of target proteins. BCR complexes and ARIH1 collaborate in tandem to mediate ubiquitination of target proteins (PubMed:27565346). As a scaffold protein may contribute to catalysis through positioning of the substrate and the ubiquitin-conjugating enzyme. The E3 ubiquitin-protein ligase activity of the complex is dependent on the neddylation of the cullin subunit and is inhibited by the association of the deneddylated cullin subunit with TIP120A/CAND1. The functional specificity of the BCR complex depends on the BTB domain-containing protein as the substrate recognition component. BCR(KLHL42) is involved in ubiquitination of KATNA1. BCR(SPOP) is involved in ubiquitination of BMI1/PCGF4, BRMS1, MACROH2A1 and DAXX, GLI2 and GLI3. Can also form a cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex containing homodimeric SPOPL or the heterodimer formed by SPOP and SPOPL; these complexes have lower ubiquitin ligase activity. BCR(KLHL9-KLHL13) controls the dynamic behavior of AURKB on mitotic chromosomes and thereby coordinates faithful mitotic progression and completion of cytokinesis. BCR(KLHL12) is involved in ER-Golgi transport by regulating the size of COPII coats, thereby playing a key role in collagen export, which is required for embryonic stem (ES) cells division: BCR(KLHL12) acts by mediating monoubiquitination of SEC31 (SEC31A or SEC31B) (PubMed:22358839, PubMed:27716508). BCR(KLHL3) acts as a regulator of ion transport in the distal nephron; by mediating ubiquitination of WNK4 (PubMed:23387299, PubMed:23453970, PubMed:23576762). The BCR(KLHL20) E3 ubiquitin ligase complex is involved in interferon response and anterograde Golgi to endosome transport: it mediates both ubiquitination leading to degradation and 'Lys-33'-linked ubiquitination (PubMed:20389280, PubMed:21670212, PubMed:21840486, PubMed:24768539). The BCR(KLHL21) E3 ubiquitin ligase complex regulates localization of the chromosomal passenger complex (CPC) from chromosomes to the spindle midzone in anaphase and mediates the ubiquitination of AURKB (PubMed:19995937). The BCR(KLHL22) ubiquitin ligase complex mediates monoubiquitination of PLK1, leading to PLK1 dissociation from phosphoreceptor proteins and subsequent removal from kinetochores, allowing silencing of the spindle assembly checkpoint (SAC) and chromosome segregation (PubMed:23455478). The BCR(KLHL22) ubiquitin ligase complex is also responsible for the amino acid-stimulated 'Lys-48' polyubiquitination and proteasomal degradation of DEPDC5. Through the degradation of DEPDC5, releases the GATOR1 complex-mediated inhibition of the TORC1 pathway (PubMed:29769719). The BCR(KLHL25) ubiquitin ligase complex is involved in translational homeostasis by mediating ubiquitination and subsequent degradation of hypophosphorylated EIF4EBP1 (4E-BP1) (PubMed:22578813). The BCR(KLHL25) ubiquitin ligase complex is also involved in lipid synthesis by mediating ubiquitination and degradation of ACLY (PubMed:27664236). The BCR(KBTBD8) complex acts by mediating monoubiquitination of NOLC1 and TCOF1, leading to remodel the translational program of differentiating cells in favor of neural crest specification (PubMed:26399832). Involved in ubiquitination of cyclin E and of cyclin D1 (in vitro) thus involved in regulation of G1/S transition. Involved in the ubiquitination of KEAP1, ENC1 and KLHL41 (PubMed:15983046). In concert with ATF2 and RBX1, promotes degradation of KAT5 thereby attenuating its ability to acetylate and activate ATM. The BCR(KCTD17) E3 ubiquitin ligase complex mediates ubiquitination and degradation of TCHP, a down-regulator of cilium assembly, thereby inducing ciliogenesis (PubMed:25270598). The BCR(KLHL24) E3 ubiquitin ligase complex mediates ubiquitination of KRT14, controls KRT14 levels during keratinocytes differentiation, and is essential for skin integrity (PubMed:27798626). The BCR(KLHL18) E3 ubiquitin ligase complex mediates the ubiquitination of AURKA leading to its activation at the centrosome which is required for initiating mitotic entry (PubMed:23213400). The BCR(KEAP1) E3 ubiquitin ligase complex acts as a key sensor of oxidative and electrophilic stress by mediating ubiquitination and degradation of NFE2L2/NRF2, a transcription factor regulating expression of many cytoprotective genes (PubMed:15601839, PubMed:16006525). As part of the CUL3(KBTBD6/7) E3 ubiquitin ligase complex functions mediates 'Lys-48' ubiquitination and proteasomal degradation of TIAM1 (PubMed:25684205). By controlling the ubiquitination of that RAC1 guanine exchange factors (GEF), regulates RAC1 signal transduction and downstream biological processes including the organization of the cytoskeleton, cell migration and cell proliferation (PubMed:25684205). The BCR(KBTBD4) E3 ubiquitin ligase complex targets CoREST corepressor complex components RCOR1, KDM1A/LSD1 and HDAC2 for proteasomal degradation with RCOR1 likely to be the primary target while degradation of KDM1A and HDAC2 is likely due to their association with RCOR1 (PubMed:33417871). It also targets RCOR3, MIER2 and MIER3 for proteasomal degradation as well as associated proteins ZNF217 and RREB1 with degradation being dependent on the presence of an ELM2 domain in the target proteins (PubMed:36997086). The BCR(ARMC5) complex mediates premature transcription termination of transcripts that are unfavorably configured for transcriptional elongation by mediating ubiquitination of Pol II subunit POLR2A (PubMed:35687106, PubMed:38225631, PubMed:39504960, PubMed:39667934). Required for 'Lys-63'-linked ubiquitination of large ribosomal subunit protein MRPL12 (PubMed:37526061)..
- Molecular Weight
- 89kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0102
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat