Antibodies
Anti-CUL4A Antibody-Oligo Conjugate
SKU: aoc1766
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CUL4A Antibody-IF1
Antibody Target
- Target
- Cullin-4A
- UniProt Number
- Q13619
- Target Description
- Core component of multiple cullin-RING-based E3 ubiquitin-protein ligase complexes which mediate the ubiquitination of target proteins. As a scaffold protein may contribute to catalysis through positioning of the substrate and the ubiquitin-conjugating enzyme. The E3 ubiquitin-protein ligase activity of the complex is dependent on the neddylation of the cullin subunit and is inhibited by the association of the deneddylated cullin subunit with TIP120A/CAND1. The functional specificity of the E3 ubiquitin-protein ligase complex depends on the variable substrate recognition component. DCX(DET1-COP1) directs ubiquitination of JUN. DCX(DDB2) directs ubiquitination of XPC. DCX(DDB2) ubiquitinates histones H3-H4 and is required for efficient histone deposition during replication-coupled (H3.1) and replication-independent (H3.3) nucleosome assembly, probably by facilitating the transfer of H3 from ASF1A/ASF1B to other chaperones involved in histone deposition. DCX(DTL) plays a role in PCNA-dependent polyubiquitination of CDT1 and MDM2-dependent ubiquitination of p53/TP53 in response to radiation-induced DNA damage and during DNA replication. DCX(DTL) directs autoubiquitination of DTL. In association with DDB1 and SKP2 probably is involved in ubiquitination of CDKN1B/p27kip. Is involved in ubiquitination of HOXA9. The DDB1-CUL4A-DTL E3 ligase complex regulates the circadian clock function by mediating the ubiquitination and degradation of CRY1. The DCX(ERCC8) complex (also named CSA complex) plays a role in transcription-coupled repair (TCR). A number of DCX complexes (containing either TRPC4AP or DCAF12 as substrate-recognition component) are part of the DesCEND (destruction via C-end degrons) pathway, which recognizes a C-degron located at the extreme C terminus of target proteins, leading to their ubiquitination and degradation. The DCX(AMBRA1) complex is a master regulator of the transition from G1 to S cell phase by mediating ubiquitination of phosphorylated cyclin-D (CCND1, CCND2 and CCND3). The DCX(AMBRA1) complex also acts as a regulator of Cul5-RING (CRL5) E3 ubiquitin-protein ligase complexes by mediating ubiquitination and degradation of Elongin-C (ELOC) component of CRL5 complexes. With CUL4B, contributes to ribosome biogenesis.
- Molecular Weight
- 88kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1237
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human