Antibodies

Anti-CUL4A Antibody-Oligo Conjugate

SKU: aoc1766

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-CUL4A Antibody-IF1

Antibody Target

Target
Cullin-4A
UniProt Number
Q13619
Target Description
Core component of multiple cullin-RING-based E3 ubiquitin-protein ligase complexes which mediate the ubiquitination of target proteins (PubMed:14578910, PubMed:14739464, PubMed:15448697, PubMed:15548678, PubMed:15811626, PubMed:16678110, PubMed:17041588, PubMed:24209620, PubMed:30166453, PubMed:33854232, PubMed:33854239). As a scaffold protein may contribute to catalysis through positioning of the substrate and the ubiquitin-conjugating enzyme (PubMed:14578910, PubMed:14739464, PubMed:15448697, PubMed:15548678, PubMed:15811626, PubMed:16678110, PubMed:17041588, PubMed:24209620). The E3 ubiquitin-protein ligase activity of the complex is dependent on the neddylation of the cullin subunit and is inhibited by the association of the deneddylated cullin subunit with TIP120A/CAND1 (PubMed:14578910, PubMed:14739464, PubMed:15448697, PubMed:15548678, PubMed:15811626, PubMed:16678110, PubMed:17041588, PubMed:24209620). The functional specificity of the E3 ubiquitin-protein ligase complex depends on the variable substrate recognition component (PubMed:14578910, PubMed:14739464, PubMed:15448697, PubMed:15548678, PubMed:15811626, PubMed:16678110, PubMed:17041588, PubMed:24209620). DCX(DET1-COP1) directs ubiquitination of JUN (PubMed:14739464). DCX(DDB2) directs ubiquitination of XPC (PubMed:15811626). DCX(DDB2) ubiquitinates histones H3-H4 and is required for efficient histone deposition during replication-coupled (H3.1) and replication-independent (H3.3) nucleosome assembly, probably by facilitating the transfer of H3 from ASF1A/ASF1B to other chaperones involved in histone deposition (PubMed:16678110, PubMed:17041588, PubMed:24209620). DCX(DTL) plays a role in PCNA-dependent polyubiquitination of CDT1 and MDM2-dependent ubiquitination of p53/TP53 in response to radiation-induced DNA damage and during DNA replication (PubMed:14578910, PubMed:15448697, PubMed:15548678). DCX(DTL) directs autoubiquitination of DTL (PubMed:23478445). In association with DDB1 and SKP2 probably is involved in ubiquitination of CDKN1B/p27kip (PubMed:16537899). Is involved in ubiquitination of HOXA9 (PubMed:14609952). The DDB1-CUL4A-DTL E3 ligase complex regulates the circadian clock function by mediating the ubiquitination and degradation of CRY1 (PubMed:26431207). The DCX(ERCC8) complex (also named CSA complex) plays a role in transcription-coupled repair (TCR) (PubMed:12732143, PubMed:32355176, PubMed:38316879). A number of DCX complexes (containing either TRPC4AP or DCAF12 as substrate-recognition component) are part of the DesCEND (destruction via C-end degrons) pathway, which recognizes a C-degron located at the extreme C terminus of target proteins, leading to their ubiquitination and degradation (PubMed:29779948). The DCX(AMBRA1) complex is a master regulator of the transition from G1 to S cell phase by mediating ubiquitination of phosphorylated cyclin-D (CCND1, CCND2 and CCND3) (PubMed:33854232, PubMed:33854239). The DCX(AMBRA1) complex also acts as a regulator of Cul5-RING (CRL5) E3 ubiquitin-protein ligase complexes by mediating ubiquitination and degradation of Elongin-C (ELOC) component of CRL5 complexes (PubMed:30166453). With CUL4B, contributes to ribosome biogenesis (PubMed:26711351)..
Molecular Weight
88kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCELISA
Clone
ARC1237
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
Human