Antibodies
Anti-CXADR Antibody-Oligo Conjugate
SKU: aoc1768
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CXADR Antibody-IF1
Antibody Target
- Target
- Coxsackievirus and adenovirus receptor
- UniProt Number
- P78310
- Target Description
- Component of the epithelial apical junction complex that may function as a homophilic cell adhesion molecule and is essential for tight junction integrity. Also involved in transepithelial migration of leukocytes through adhesive interactions with JAML a transmembrane protein of the plasma membrane of leukocytes. The interaction between both receptors also mediates the activation of gamma-delta T-cells, a subpopulation of T-cells residing in epithelia and involved in tissue homeostasis and repair. Upon epithelial CXADR-binding, JAML induces downstream cell signaling events in gamma-delta T-cells through PI3-kinase and MAP kinases. It results in proliferation and production of cytokines and growth factors by T-cells that in turn stimulate epithelial tissues repair.; FUNCTION: (Microbial infection) Acts as a receptor for adenovirus type C.; FUNCTION: (Microbial infection) Acts as a receptor for Coxsackievirus B1 to B6.
- Molecular Weight
- 40kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC58170
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat