Antibodies
Anti-CXCL10 Antibody-Oligo Conjugate
SKU: aoc1770
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CXCL10 Antibody-IF1
Antibody Target
- Target
- C-X-C motif chemokine 10
- UniProt Number
- P02778
- Target Description
- Pro-inflammatory cytokine that is involved in a wide variety of processes such as chemotaxis, differentiation, and activation of peripheral immune cells, regulation of cell growth, apoptosis and modulation of angiostatic effects. Plays thereby an important role during viral infections by stimulating the activation and migration of immune cells to the infected sites. Mechanistically, binding of CXCL10 to the CXCR3 receptor activates G protein-mediated signaling and results in downstream activation of phospholipase C-dependent pathway, an increase in intracellular calcium production and actin reorganization. In turn, recruitment of activated Th1 lymphocytes occurs at sites of inflammation. Activation of the CXCL10/CXCR3 axis also plays an important role in neurons in response to brain injury for activating microglia, the resident macrophage population of the central nervous system, and directing them to the lesion site. This recruitment is an essential element for neuronal reorganization.
- Molecular Weight
- 11kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC72854
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human