Antibodies
Anti-Cyclin H Antibody-Oligo Conjugate (ARC0893)
SKU: aoc1789
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Cyclin H Antibody (ARC0893)-IF1
Antibody Target
- Target
- Cyclin-H
- UniProt Number
- P51946
- Target Description
- Regulates CDK7, the catalytic subunit of the CDK-activating kinase (CAK) enzymatic complex. CAK activates the cyclin-associated kinases CDK1, CDK2, CDK4 and CDK6 by threonine phosphorylation. CAK complexed to the core-TFIIH basal transcription factor activates RNA polymerase II by serine phosphorylation of the repetitive C-terminal domain (CTD) of its large subunit (POLR2A), allowing its escape from the promoter and elongation of the transcripts. Involved in cell cycle control and in RNA transcription by RNA polymerase II. Its expression and activity are constant throughout the cell cycle.
- Molecular Weight
- 38kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC0893
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse