Antibodies
Anti-Cyclophilin F Antibody-Oligo Conjugate
SKU: aoc1791
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Cyclophilin F Antibody-IF1
Antibody Target
- Target
- Peptidyl-prolyl cis-trans isomerase F, mitochondrial
- UniProt Number
- P30405
- Target Description
- PPIase that catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and may therefore assist protein folding (PubMed:20676357). Involved in regulation of the mitochondrial permeability transition pore (mPTP) (PubMed:26387735). It is proposed that its association with the mPTP is masking a binding site for inhibiting inorganic phosphate (Pi) and promotes the open probability of the mPTP leading to apoptosis or necrosis; the requirement of the PPIase activity for this function is debated (PubMed:26387735). In cooperation with mitochondrial p53/TP53 is involved in activating oxidative stress-induced necrosis (PubMed:22726440). Involved in modulation of mitochondrial membrane F(1)F(0) ATP synthase activity and regulation of mitochondrial matrix adenine nucleotide levels (By similarity). Has anti-apoptotic activity independently of mPTP and in cooperation with BCL2 inhibits cytochrome c-dependent apoptosis (PubMed:19228691)..
- Molecular Weight
- 22kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC66521
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human