Antibodies
Anti-CYFIP1 Antibody-Oligo Conjugate
SKU: aoc1792
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CYFIP1 Antibody-IF1
Antibody Target
- Target
- Cytoplasmic FMR1-interacting protein 1
- UniProt Number
- Q7L576
- Target Description
- Component of the CYFIP1-EIF4E-FMR1 complex which binds to the mRNA cap and mediates translational repression. In the CYFIP1-EIF4E-FMR1 complex this subunit is an adapter between EIF4E and FMR1. Promotes the translation repression activity of FMR1 in brain probably by mediating its association with EIF4E and mRNA (By similarity). Regulates formation of membrane ruffles and lamellipodia. Plays a role in axon outgrowth. Binds to F-actin but not to RNA. Part of the WAVE complex that regulates actin filament reorganization via its interaction with the Arp2/3 complex. Actin remodeling activity is regulated by RAC1. Regulator of epithelial morphogenesis. As component of the WAVE1 complex, required for BDNF-NTRK2 endocytic trafficking and signaling from early endosomes (By similarity). May act as an invasion suppressor in cancers..
- Molecular Weight
- 145kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2899
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat