Antibodies
Anti-CYP24A1 Antibody-Oligo Conjugate
SKU: aoc1794
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CYP24A1 Antibody-IF1
Antibody Target
- Target
- 1,25-dihydroxyvitamin D
- UniProt Number
- Q07973
- Target Description
- A cytochrome P450 monooxygenase with a key role in vitamin D catabolism and calcium homeostasis. Via C24- and C23-oxidation pathways, catalyzes the inactivation of both the vitamin D precursor calcidiol (25-hydroxyvitamin D(3)) and the active hormone calcitriol (1-alpha,25-dihydroxyvitamin D(3)) (PubMed:11012668, PubMed:15574355, PubMed:16617161, PubMed:24893882, PubMed:29461981, PubMed:8679605). With initial hydroxylation at C-24 (via C24-oxidation pathway), performs a sequential 6-step oxidation of calcitriol leading to the formation of the biliary metabolite calcitroic acid (PubMed:15574355, PubMed:24893882). With initial hydroxylation at C-23 (via C23-oxidation pathway), catalyzes sequential oxidation of calcidiol leading to the formation of 25(OH)D3-26,23-lactone as end product (PubMed:11012668, PubMed:8679605). Preferentially hydroxylates at C-25 other vitamin D active metabolites, such as CYP11A1-derived secosteroids 20S-hydroxycholecalciferol and 20S,23-dihydroxycholecalciferol (PubMed:25727742). Mechanistically, uses molecular oxygen inserting one oxygen atom into a substrate, and reducing the second into a water molecule, with two electrons provided by NADPH via FDXR/adrenodoxin reductase and FDX1/adrenodoxin (PubMed:8679605)..
- Molecular Weight
- 59kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCICCELISA
- Clone
- ARC58733
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human