Antibodies
Anti-CYP26A1 Antibody-Oligo Conjugate
SKU: aoc1795
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CYP26A1 Antibody-IF1
Antibody Target
- Target
- Cytochrome P450 26A1
- UniProt Number
- O43174
- Target Description
- A cytochrome P450 monooxygenase involved in the metabolism of retinoates (RAs), the active metabolites of vitamin A, and critical signaling molecules in animals (PubMed:22020119, PubMed:9228017, PubMed:9716180). RAs exist as at least four different isomers: all-trans-RA (atRA), 9-cis-RA, 13-cis-RA, and 9,13-dicis-RA, where atRA is considered to be the biologically active isomer, although 9-cis-RA and 13-cis-RA also have activity (Probable). Catalyzes the hydroxylation of atRA primarily at C-4 and C-18, thereby contributing to the regulation of atRA homeostasis and signaling (PubMed:22020119, PubMed:9228017, PubMed:9716180). Hydroxylation of atRA limits its biological activity and initiates a degradative process leading to its eventual elimination (Probable). Involved in the convertion of atRA to all-trans-4-oxo-RA. Able to metabolize other RAs such as 9-cis, 13-cis and 9,13-di-cis RA (By similarity) (PubMed:9228017). Can oxidize all-trans-13,14-dihydroretinoate (DRA) to metabolites which could include all-trans-4-oxo-DRA, all-trans-4-hydroxy-DRA, all-trans-5,8-epoxy-DRA, and all-trans-18-hydroxy-DRA (By similarity). May play a role in the oxidative metabolism of xenobiotics such as tazarotenic acid (PubMed:26937021)..
- Molecular Weight
- 56 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC2126
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat