Antibodies
Anti-CYP51A1 Antibody-Oligo Conjugate
SKU: aoc1800
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CYP51A1 Antibody-IF1
Antibody Target
- Target
- Lanosterol 14-alpha demethylase
- UniProt Number
- Q16850
- Target Description
- Sterol 14alpha-demethylase that plays a critical role in the cholesterol biosynthesis pathway, being cholesterol the major sterol component in mammalian membranes as well as a precursor for bile acid and steroid hormone synthesis. Cytochrome P450 monooxygenase that catalyzes the three-step oxidative removal of the 14alpha-methyl group (C-32) of sterols such as lanosterol (lanosta-8,24-dien-3beta-ol) and 24,25-dihydrolanosterol (DHL) in the form of formate, and converts the sterols to 4,4-dimethyl-5alpha-cholesta-8,14,24-trien-3beta-ol and 4,4-dimethyl-8,14-cholestadien-3beta-ol, respectively, which are intermediates of cholesterol biosynthesis. Can also demethylate substrates not intrinsic to mammals, such as eburicol (24-methylene-24,25-dihydrolanosterol), but at a lower rate than DHL.
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC59516
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat