Antibodies
Anti-Cytochrome C Antibody-Oligo Conjugate (ARC70629)
SKU: aoc1806
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Cytochrome C Antibody (ARC70629)-IF1
Antibody Target
- Target
- Cytochrome c
- UniProt Number
- P99999
- Target Description
- Electron carrier protein. The oxidized form of the cytochrome c heme group can accept an electron from the heme group of the cytochrome c1 subunit of cytochrome reductase. Cytochrome c then transfers this electron to the cytochrome oxidase complex, the final protein carrier in the mitochondrial electron-transport chain.; FUNCTION: Plays a role in apoptosis. Suppression of the anti-apoptotic members or activation of the pro-apoptotic members of the Bcl-2 family leads to altered mitochondrial membrane permeability resulting in release of cytochrome c into the cytosol. Binding of cytochrome c to Apaf-1 triggers the activation of caspase-9, which then accelerates apoptosis by activating other caspases.
- Molecular Weight
- 12kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC70629
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat