Antibodies
Anti-Cytochrome P450 Antibody-Oligo Conjugate (ARC58003)
SKU: aoc1808
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Cytochrome P450 Antibody (ARC58003)-IF1
Antibody Target
- Target
- Cytochrome P450 2E1
- UniProt Number
- P05181
- Target Description
- A cytochrome P450 monooxygenase involved in the metabolism of fatty acids (PubMed:10553002, PubMed:18577768). Mechanistically, uses molecular oxygen inserting one oxygen atom into a substrate, and reducing the second into a water molecule, with two electrons provided by NADPH via cytochrome P450 reductase (NADPH--hemoprotein reductase) (PubMed:10553002, PubMed:18577768). Catalyzes the hydroxylation of carbon-hydrogen bonds. Hydroxylates fatty acids specifically at the omega-1 position displaying the highest catalytic activity for saturated fatty acids (PubMed:10553002, PubMed:18577768). May be involved in the oxidative metabolism of xenobiotics (Probable)..
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC58003
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat