Antibodies
Anti-Cytokeratin 2e Antibody-Oligo Conjugate
SKU: aoc1825
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Cytokeratin 2e Antibody-IF1
Antibody Target
- Target
- Keratin, type II cytoskeletal 2 epidermal
- UniProt Number
- P35908
- Target Description
- Probably contributes to terminal cornification. Associated with keratinocyte activation, proliferation and keratinization. Required for maintenance of corneocytes and keratin filaments in suprabasal keratinocytes in the epidermis of the ear, potentially via moderation of expression and localization of keratins and their partner proteins. Plays a role in the establishment of the epidermal barrier on plantar skin.
- Molecular Weight
- 65kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC1925
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat