Antibodies
Anti-Cytokeratin 5 Antibody-Oligo Conjugate
SKU: aoc1827
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Cytokeratin 5 Antibody-IF1
Antibody Target
- Target
- Keratin, type II cytoskeletal 5
- UniProt Number
- P13647
- Target Description
- Required for the formation of keratin intermediate filaments in the basal epidermis and maintenance of the skin barrier in response to mechanical stress (By similarity). Regulates the recruitment of Langerhans cells to the epidermis, potentially by modulation of the abundance of macrophage chemotactic cytokines, macrophage inflammatory cytokines and CTNND1 localization in keratinocytes (By similarity)..
- Molecular Weight
- 62 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC0585
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat