Antibodies
Anti-Cytokeratin 7 Antibody-Oligo Conjugate (ARC0978)
SKU: aoc1832
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Cytokeratin 7 Antibody (ARC0978)-IF1
Antibody Target
- Target
- Keratin, type II cytoskeletal 7
- UniProt Number
- P08729
- Target Description
- Blocks interferon-dependent interphase and stimulates DNA synthesis in cells. Involved in the translational regulation of the human papillomavirus type 16 E7 mRNA (HPV16 E7).
- Molecular Weight
- 51 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC0978
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat