Antibodies
Anti-DC-SIGNR/CD299 Antibody-Oligo Conjugate
SKU: aoc1850
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DC-SIGNR/CD299 Antibody-IF1
Antibody Target
- Target
- C-type lectin domain family 4 member M
- UniProt Number
- Q9H2X3
- Target Description
- Probable pathogen-recognition receptor involved in peripheral immune surveillance in liver. May mediate the endocytosis of pathogens which are subsequently degraded in lysosomal compartments. Is a receptor for ICAM3, probably by binding to mannose-like carbohydrates..; FUNCTION: (Microbial infection) Acts as an attachment receptor for Ebolavirus..; FUNCTION: (Microbial infection) Acts as an attachment receptor for Hepatitis C virus..; FUNCTION: (Microbial infection) Acts as an attachment receptor for HIV-1..; FUNCTION: (Microbial infection) Acts as an attachment receptor for Human coronavirus 229E..; FUNCTION: (Microbial infection) Acts as an attachment receptor for Human cytomegalovirus/HHV-5..; FUNCTION: (Microbial infection) Acts as an attachment receptor for Influenzavirus..; FUNCTION: (Microbial infection) Acts as an attachment receptor for SARS-CoV..; FUNCTION: (Microbial infection) Acts as an attachment receptor for West-nile virus..; FUNCTION: (Microbial infection) Acts as an attachment receptor for Japanese encephalitis virus..; FUNCTION: (Microbial infection) Acts as an attachment receptor for Marburg virus glycoprotein..; FUNCTION: (Microbial infection) Recognition of M.bovis by dendritic cells may occur partially via this molecule..
- Molecular Weight
- 24-45KDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCFlow CytometryELISA
- Clone
- ARC59314
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human