Antibodies
Anti-DCK Antibody-Oligo Conjugate
SKU: aoc1844
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DCK Antibody-IF1
Antibody Target
- Target
- Deoxycytidine kinase
- UniProt Number
- P27707
- Target Description
- Phosphorylates the deoxyribonucleosides deoxycytidine, deoxyguanosine and deoxyadenosine. Has broad substrate specificity, and does not display selectivity based on the chirality of the substrate. It is also an essential enzyme for the phosphorylation of numerous nucleoside analogs widely employed as antiviral and chemotherapeutic agents.
- Molecular Weight
- 31kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC65397
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat