Antibodies
Anti-DCP1A Antibody-Oligo Conjugate
SKU: aoc1846
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DCP1A Antibody-IF1
Antibody Target
- Target
- mRNA-decapping enzyme 1A
- UniProt Number
- Q9NPI6
- Target Description
- Necessary for the degradation of mRNAs, both in normal mRNA turnover and in nonsense-mediated mRNA decay. Removes the 7-methyl guanine cap structure from mRNA molecules, yielding a 5'-phosphorylated mRNA fragment and 7m-GDP. Contributes to the transactivation of target genes after stimulation by TGFB1. Essential for embryonic development.
- Molecular Weight
- 63kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1421
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse