Antibodies
Anti-DcR2 Antibody-Oligo Conjugate
SKU: aoc1849
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DcR2 Antibody-IF1
Antibody Target
- Target
- Tumor necrosis factor receptor superfamily member 10D
- UniProt Number
- Q9UBN6
- Target Description
- Receptor for the cytotoxic ligand TRAIL (PubMed:9430226). Contains a truncated death domain and hence is not capable of inducing apoptosis but protects against TRAIL-mediated apoptosis (PubMed:9537512). Reports are contradictory with regards to its ability to induce the NF-kappa-B pathway. According to PubMed:9382840, it cannot but according to PubMed:9430226, it can induce the NF-kappa-B pathway (PubMed:9382840, PubMed:9430226)..
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2052
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat