Antibodies

Anti-DDB1 Antibody-Oligo Conjugate

SKU: aoc1854

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-DDB1 Antibody-IF1

Antibody Target

Target
DNA damage-binding protein 1
UniProt Number
Q16531
Target Description
Protein, which is both involved in DNA repair and protein ubiquitination, as part of the UV-DDB complex and DCX (DDB1-CUL4-X-box) complexes, respectively (PubMed:14739464, PubMed:15448697, PubMed:16260596, PubMed:16407242, PubMed:16407252, PubMed:16482215, PubMed:16940174, PubMed:17079684). Core component of the UV-DDB complex (UV-damaged DNA-binding protein complex), a complex that recognizes UV-induced DNA damage and recruit proteins of the nucleotide excision repair pathway (the NER pathway) to initiate DNA repair (PubMed:15448697, PubMed:16260596, PubMed:16407242, PubMed:16940174). The UV-DDB complex preferentially binds to cyclobutane pyrimidine dimers (CPD), 6-4 photoproducts (6-4 PP), apurinic sites and short mismatches (PubMed:15448697, PubMed:16260596, PubMed:16407242, PubMed:16940174). Also functions as a component of numerous distinct DCX (DDB1-CUL4-X-box) E3 ubiquitin-protein ligase complexes which mediate the ubiquitination and subsequent proteasomal degradation of target proteins (PubMed:14739464, PubMed:16407252, PubMed:16482215, PubMed:17079684, PubMed:18332868, PubMed:18381890, PubMed:19966799, PubMed:22118460, PubMed:25043012, PubMed:25108355, PubMed:28886238). The functional specificity of the DCX E3 ubiquitin-protein ligase complex is determined by the variable substrate recognition component recruited by DDB1 (PubMed:14739464, PubMed:16407252, PubMed:16482215, PubMed:17079684, PubMed:18332868, PubMed:18381890, PubMed:19966799, PubMed:22118460, PubMed:25043012, PubMed:25108355). DCX(DDB2) (also known as DDB1-CUL4-ROC1, CUL4-DDB-ROC1 and CUL4-DDB-RBX1) may ubiquitinate histone H2A, histone H3 and histone H4 at sites of UV-induced DNA damage (PubMed:16473935, PubMed:16678110, PubMed:17041588, PubMed:18593899). The ubiquitination of histones may facilitate their removal from the nucleosome and promote subsequent DNA repair (PubMed:16473935, PubMed:16678110, PubMed:17041588, PubMed:18593899). DCX(DDB2) also ubiquitinates XPC, which may enhance DNA-binding by XPC and promote NER (PubMed:15882621). DCX(DTL) plays a role in PCNA-dependent polyubiquitination of CDT1 and MDM2-dependent ubiquitination of TP53 in response to radiation-induced DNA damage and during DNA replication (PubMed:17041588). DCX(ERCC8) (the CSA complex) plays a role in transcription-coupled repair (TCR) (PubMed:12732143, PubMed:32355176, PubMed:38316879). The DDB1-CUL4A-DTL E3 ligase complex regulates the circadian clock function by mediating the ubiquitination and degradation of CRY1 (PubMed:26431207). DDB1-mediated CRY1 degradation promotes FOXO1 protein stability and FOXO1-mediated gluconeogenesis in the liver (By similarity). By acting on TET dioxygenses, essential for oocyte maintenance at the primordial follicle stage, hence essential for female fertility (By similarity). Maternal factor required for proper zygotic genome activation and genome reprogramming (By similarity)..
Molecular Weight
127kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCELISA
Clone
ARC1278
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat