Antibodies
Anti-DDX1 Antibody-Oligo Conjugate
SKU: aoc1858
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DDX1 Antibody-IF1
Antibody Target
- Target
- ATP-dependent RNA helicase DDX1
- UniProt Number
- Q92499
- Target Description
- Acts as an ATP-dependent RNA helicase, able to unwind both RNA-RNA and RNA-DNA duplexes. Possesses 5' single-stranded RNA overhang nuclease activity. Possesses ATPase activity on various RNA, but not DNA polynucleotides. May play a role in RNA clearance at DNA double-strand breaks (DSBs), thereby facilitating the template-guided repair of transcriptionally active regions of the genome. Together with RELA, acts as a coactivator to enhance NF-kappa-B-mediated transcriptional activation. Acts as a positive transcriptional regulator of cyclin CCND2 expression. Binds to the cyclin CCND2 promoter region. Associates with chromatin at the NF-kappa-B promoter region via association with RELA. Binds to poly(A) RNA. May be involved in 3'-end cleavage and polyadenylation of pre-mRNAs. Component of the tRNA-splicing ligase complex required to facilitate the enzymatic turnover of catalytic subunit RTCB: together with archease (ZBTB8OS), acts by facilitating the guanylylation of RTCB, a key intermediate step in tRNA ligation. Component of a multi-helicase-TICAM1 complex that acts as a cytoplasmic sensor of viral double-stranded RNA (dsRNA) and plays a role in the activation of a cascade of antiviral responses including the induction of pro-inflammatory cytokines via the adapter molecule TICAM1. Specifically binds (via helicase ATP-binding domain) on both short and long poly(I:C) dsRNA.; FUNCTION: (Microbial infection) Required for HIV-1 Rev function as well as for HIV-1 and coronavirus IBV replication. Binds to the RRE sequence of HIV-1 mRNAs.; FUNCTION: (Microbial infection) Required for Coronavirus IBV replication.
- Molecular Weight
- 82 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC65523
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat