Antibodies
Anti-DDX4 / MVH Antibody-Oligo Conjugate
SKU: aoc1862
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DDX4 / MVH Antibody-IF1
Antibody Target
- Target
- Probable ATP-dependent RNA helicase DDX4
- UniProt Number
- Q9NQI0
- Target Description
- ATP-dependent RNA helicase required during spermatogenesis. Required to repress transposable elements and preventing their mobilization, which is essential for the germline integrity. Acts via the piRNA metabolic process, which mediates the repression of transposable elements during meiosis by forming complexes composed of piRNAs and Piwi proteins and governs the methylation and subsequent repression of transposons. Involved in the secondary piRNAs metabolic process, the production of piRNAs in fetal male germ cells through a ping-pong amplification cycle. Required for PIWIL2 slicing-triggered piRNA biogenesis: helicase activity enables utilization of one of the slice cleavage fragments generated by PIWIL2 and processing these pre-piRNAs into piRNAs.
- Molecular Weight
- 79kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIF-PIHCELISA
- Clone
- ARC72110
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat