Antibodies
Anti-DENN Antibody-Oligo Conjugate
SKU: aoc1868
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DENN Antibody-IF1
Antibody Target
- Target
- MAP kinase-activating death domain protein
- UniProt Number
- Q8WXG6
- Target Description
- Guanyl-nucleotide exchange factor that regulates small GTPases of the Rab family. Converts GDP-bound inactive form of RAB27A and RAB27B to the GTP-bound active forms. Converts GDP-bound inactive form of RAB3A, RAB3C and RAB3D to the GTP-bound active forms, GTPases involved in synaptic vesicle exocytosis and vesicle secretion. Plays a role in synaptic vesicle formation and in vesicle trafficking at the neuromuscular junction. Involved in up-regulating a post-docking step of synaptic exocytosis in central synapses. Probably by binding to the motor proteins KIF1B and KIF1A, mediates motor-dependent transport of GTP-RAB3A-positive vesicles to the presynaptic nerve terminals. Plays a role in TNFA-mediated activation of the MAPK pathway, including ERK1/2. May link TNFRSF1A with MAP kinase activation. May be involved in the regulation of TNFA-induced apoptosis.
- Molecular Weight
- 183kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2860
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat