Antibodies
Anti-Desmin Antibody-Oligo Conjugate
SKU: aoc1869
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Desmin Antibody-IF1
Antibody Target
- Target
- Desmin
- UniProt Number
- P17661
- Target Description
- Muscle-specific type III intermediate filament essential for proper muscular structure and function. Plays a crucial role in maintaining the structure of sarcomeres, inter-connecting the Z-disks and forming the myofibrils, linking them not only to the sarcolemmal cytoskeleton, but also to the nucleus and mitochondria, thus providing strength for the muscle fiber during activity (PubMed:25358400). In adult striated muscle they form a fibrous network connecting myofibrils to each other and to the plasma membrane from the periphery of the Z-line structures (PubMed:24200904, PubMed:25394388, PubMed:26724190). May act as a sarcomeric microtubule-anchoring protein: specifically associates with detyrosinated tubulin-alpha chains, leading to buckled microtubules and mechanical resistance to contraction. Required for nuclear membrane integrity, via anchoring at the cell tip and nuclear envelope, resulting in maintenance of microtubule-derived intracellular mechanical forces (By similarity). Contributes to the transcriptional regulation of the NKX2-5 gene in cardiac progenitor cells during a short period of cardiomyogenesis and in cardiac side population stem cells in the adult. Plays a role in maintaining an optimal conformation of nebulette (NEB) on heart muscle sarcomeres to bind and recruit cardiac alpha-actin (By similarity)..
- Molecular Weight
- 54 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC0235
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat