Antibodies
Anti-Desmin Antibody-Oligo Conjugate
SKU: aoc1869
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Desmin Antibody-IF1
Antibody Target
- Target
- Desmin
- UniProt Number
- P17661
- Target Description
- Muscle-specific type III intermediate filament essential for proper muscular structure and function. Plays a crucial role in maintaining the structure of sarcomeres, inter-connecting the Z-disks and forming the myofibrils, linking them not only to the sarcolemmal cytoskeleton, but also to the nucleus and mitochondria, thus providing strength for the muscle fiber during activity. In adult striated muscle they form a fibrous network connecting myofibrils to each other and to the plasma membrane from the periphery of the Z-line structures. May act as a sarcomeric microtubule-anchoring protein: specifically associates with detyrosinated tubulin-alpha chains, leading to buckled microtubules and mechanical resistance to contraction. Required for nuclear membrane integrity, via anchoring at the cell tip and nuclear envelope, resulting in maintenance of microtubule-derived intracellular mechanical forces. Contributes to the transcriptional regulation of the NKX2-5 gene in cardiac progenitor cells during a short period of cardiomyogenesis and in cardiac side population stem cells in the adult. Plays a role in maintaining an optimal conformation of nebulette (NEB) on heart muscle sarcomeres to bind and recruit cardiac alpha-actin.
- Molecular Weight
- 54 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC0235
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat