Antibodies
Anti-DFNA5 Antibody-Oligo Conjugate (ARC70388)
SKU: aoc1876
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DFNA5 Antibody (ARC70388)-IF1
Antibody Target
- Target
- Gasdermin-E
- UniProt Number
- O60443
- Target Description
- [Gasdermin-E]: Precursor of a pore-forming protein that converts non-inflammatory apoptosis to pyroptosis. This form constitutes the precursor of the pore-forming protein: upon cleavage, the released N-terminal moiety (Gasdermin-E, N-terminal) binds to membranes and forms pores, triggering pyroptosis.; FUNCTION: [Gasdermin-E, N-terminal]: Pore-forming protein produced by cleavage by CASP3 or granzyme B (GZMB), which converts non-inflammatory apoptosis to pyroptosis or promotes granzyme-mediated pyroptosis, respectively. After cleavage, moves to the plasma membrane, homooligomerizes within the membrane and forms pores of 10-15 nanometers (nm) of inner diameter, allowing the release of mature interleukins (IL1B and IL16) and triggering pyroptosis. Binds to inner leaflet lipids, bisphosphorylated phosphatidylinositols, such as phosphatidylinositol (4,5)-bisphosphate. Cleavage by CASP3 switches CASP3-mediated apoptosis induced by TNF or danger signals, such as chemotherapy drugs, to pyroptosis. Mediates secondary necrosis downstream of the mitochondrial apoptotic pathway and CASP3 activation as well as in response to viral agents. Exhibits bactericidal activity. Cleavage by GZMB promotes tumor suppressor activity by triggering robust anti-tumor immunity. Suppresses tumors by mediating granzyme-mediated pyroptosis in target cells of natural killer (NK) cells: cleavage by granzyme B (GZMB), delivered to target cells from NK-cells, triggers pyroptosis of tumor cells and tumor suppression. May play a role in the p53/TP53-regulated cellular response to DNA damage.; FUNCTION: [Gasdermin-E, N-terminal]: (Microbial infection) Pore-forming protein, which promotes maternal placental pyroptosis in response to Zika virus infection, contributing to adverse fetal outcomes.
- Molecular Weight
- 11 kDa/35 kDa/55 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC70388
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human