Antibodies
Anti-DFNA5 Antibody-Oligo Conjugate (ARC70388)
SKU: aoc1876
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DFNA5 Antibody (ARC70388)-IF1
Antibody Target
- Target
- Gasdermin-E
- UniProt Number
- O60443
- Target Description
- [Gasdermin-E]: Precursor of a pore-forming protein that converts non-inflammatory apoptosis to pyroptosis (PubMed:27281216, PubMed:28459430, PubMed:33852854, PubMed:35594856, PubMed:36607699). This form constitutes the precursor of the pore-forming protein: upon cleavage, the released N-terminal moiety (Gasdermin-E, N-terminal) binds to membranes and forms pores, triggering pyroptosis (PubMed:28459430)..; FUNCTION: [Gasdermin-E, N-terminal]: Pore-forming protein produced by cleavage by CASP3 or granzyme B (GZMB), which converts non-inflammatory apoptosis to pyroptosis or promotes granzyme-mediated pyroptosis, respectively (PubMed:27281216, PubMed:28459430, PubMed:32188940, PubMed:33852854, PubMed:35594856). After cleavage, moves to the plasma membrane, homooligomerizes within the membrane and forms pores of 10-15 nanometers (nm) of inner diameter, allowing the release of mature interleukins (IL1B and IL16) and triggering pyroptosis (PubMed:28459430, PubMed:32188940, PubMed:33852854, PubMed:35594856). Binds to inner leaflet lipids, bisphosphorylated phosphatidylinositols, such as phosphatidylinositol (4,5)-bisphosphate (PubMed:28459430). Cleavage by CASP3 switches CASP3-mediated apoptosis induced by TNF or danger signals, such as chemotherapy drugs, to pyroptosis (PubMed:27281216, PubMed:28459430, PubMed:32188940). Mediates secondary necrosis downstream of the mitochondrial apoptotic pathway and CASP3 activation as well as in response to viral agents (PubMed:28045099). Exhibits bactericidal activity (PubMed:27281216). Cleavage by GZMB promotes tumor suppressor activity by triggering robust anti-tumor immunity (PubMed:21522185, PubMed:32188940). Suppresses tumors by mediating granzyme-mediated pyroptosis in target cells of natural killer (NK) cells: cleavage by granzyme B (GZMB), delivered to target cells from NK-cells, triggers pyroptosis of tumor cells and tumor suppression (PubMed:31953257, PubMed:32188940). May play a role in the p53/TP53-regulated cellular response to DNA damage (PubMed:16897187)..; FUNCTION: [Gasdermin-E, N-terminal]: (Microbial infection) Pore-forming protein, which promotes maternal placental pyroptosis in response to Zika virus infection, contributing to adverse fetal outcomes..
- Molecular Weight
- 11 kDa/35 kDa/55 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC70388
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human