Antibodies
Anti-Diablo Antibody-Oligo Conjugate (ARC1340)
SKU: aoc1884
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Diablo Antibody (ARC1340)-IF1
Antibody Target
- Target
- Diablo IAP-binding mitochondrial protein
- UniProt Number
- Q9NR28
- Target Description
- Promotes apoptosis by activating caspases in the cytochrome c/Apaf-1/caspase-9 pathway. Acts by opposing the inhibitory activity of inhibitor of apoptosis proteins (IAP). Inhibits the activity of BIRC6/BRUCE by inhibiting its binding to caspases (PubMed:15200957, PubMed:36758104, PubMed:36758105, PubMed:36758106)..; FUNCTION: [Isoform 3]: Attenuates the stability and apoptosis-inhibiting activity of XIAP/BIRC4 by promoting XIAP/BIRC4 ubiquitination and degradation through the ubiquitin-proteasome pathway. Also disrupts XIAP/BIRC4 interacting with processed caspase-9 and promotes caspase-3 activation..; FUNCTION: [Isoform 1]: Defective in the capacity to down-regulate the XIAP/BIRC4 abundance..
- Molecular Weight
- 27kDa/21kDa/22kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1340
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat