Antibodies
Anti-DICER Antibody-Oligo Conjugate
SKU: aoc1886
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DICER Antibody-IF1
Antibody Target
- Target
- Endoribonuclease Dicer
- UniProt Number
- Q9UPY3
- Target Description
- Double-stranded RNA (dsRNA) endoribonuclease playing a central role in short dsRNA-mediated post-transcriptional gene silencing. Cleaves naturally occurring long dsRNAs and short hairpin pre-microRNAs (miRNA) into fragments of twenty-one to twenty-three nucleotides with 3' overhang of two nucleotides, producing respectively short interfering RNAs (siRNA) and mature microRNAs. SiRNAs and miRNAs serve as guide to direct the RNA-induced silencing complex (RISC) to complementary RNAs to degrade them or prevent their translation. Gene silencing mediated by siRNAs, also called RNA interference, controls the elimination of transcripts from mobile and repetitive DNA elements of the genome but also the degradation of exogenous RNA of viral origin for instance. The miRNA pathway on the other side is a mean to specifically regulate the expression of target genes.
- Molecular Weight
- 219 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC3137
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat