Antibodies
Anti-DKC1 Antibody-Oligo Conjugate
SKU: aoc1888
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DKC1 Antibody-IF1
Antibody Target
- Target
- H/ACA ribonucleoprotein complex subunit DKC1
- UniProt Number
- O60832
- Target Description
- [Isoform 1]: Catalytic subunit of H/ACA small nucleolar ribonucleoprotein (H/ACA snoRNP) complex, which catalyzes pseudouridylation of rRNA (PubMed:25219674, PubMed:32554502). This involves the isomerization of uridine such that the ribose is subsequently attached to C5, instead of the normal N1 (PubMed:25219674). Each rRNA can contain up to 100 pseudouridine ('psi') residues, which may serve to stabilize the conformation of rRNAs. Required for ribosome biogenesis and telomere maintenance (PubMed:19179534, PubMed:25219674). Also required for correct processing or intranuclear trafficking of TERC, the RNA component of the telomerase reverse transcriptase (TERT) holoenzyme (PubMed:19179534)..; FUNCTION: [Isoform 3]: Promotes cell to cell and cell to substratum adhesion, increases the cell proliferation rate and leads to cytokeratin hyper-expression..
- Molecular Weight
- 58kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1063
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat