Antibodies
Anti-DLDH/DLD Antibody-Oligo Conjugate
SKU: aoc1892
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DLDH/DLD Antibody-IF1
Antibody Target
- Target
- Dihydrolipoyl dehydrogenase, mitochondrial
- UniProt Number
- P09622
- Target Description
- Lipoamide dehydrogenase is a component of the glycine cleavage system as well as an E3 component of three alpha-ketoacid dehydrogenase complexes (pyruvate-, alpha-ketoglutarate-, and branched-chain amino acid-dehydrogenase complex) (PubMed:15712224, PubMed:16442803, PubMed:16770810, PubMed:17404228, PubMed:20160912, PubMed:20385101). The 2-oxoglutarate dehydrogenase complex is mainly active in the mitochondrion (PubMed:29211711). A fraction of the 2-oxoglutarate dehydrogenase complex also localizes in the nucleus and is required for lysine succinylation of histones: associates with KAT2A on chromatin and provides succinyl-CoA to histone succinyltransferase KAT2A (PubMed:29211711). In monomeric form may have additional moonlighting function as serine protease (PubMed:17404228). Involved in the hyperactivation of spermatazoa during capacitation and in the spermatazoal acrosome reaction (By similarity)..
- Molecular Weight
- 54kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1224
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat