Antibodies
Anti-DLL4 Antibody-Oligo Conjugate
SKU: aoc1893
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-DLL4 Antibody-PLA1
Antibody Target
- Target
- Delta-like protein 4
- UniProt Number
- Q9NR61
- Target Description
- Involved in the Notch signaling pathway as Notch ligand. Activates NOTCH1 and NOTCH4. Involved in angiogenesis; negatively regulates endothelial cell proliferation and migration and angiogenic sprouting. Essential for retinal progenitor proliferation. Required for suppressing rod fates in late retinal progenitors as well as for proper generation of other retinal cell types. During spinal cord neurogenesis, inhibits V2a interneuron fate.
- Molecular Weight
- 75kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPFlow CytometryELISA
- Clone
- ARC67406
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human