Antibodies
Anti-DLST Antibody-Oligo Conjugate
SKU: aoc1894
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DLST Antibody-IF1
Antibody Target
- Target
- Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex, mitochondrial
- UniProt Number
- P36957
- Target Description
- Dihydrolipoamide succinyltransferase (E2) component of the 2-oxoglutarate dehydrogenase complex. The 2-oxoglutarate dehydrogenase complex catalyzes the overall conversion of 2-oxoglutarate to succinyl-CoA and CO(2). The 2-oxoglutarate dehydrogenase complex is mainly active in the mitochondrion (PubMed:29211711, PubMed:30929736). A fraction of the 2-oxoglutarate dehydrogenase complex also localizes in the nucleus and is required for lysine succinylation of histones: associates with KAT2A on chromatin and provides succinyl-CoA to histone succinyltransferase KAT2A (PubMed:29211711)..
- Molecular Weight
- 49kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC71943
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human