Antibodies
Anti-DMT1 Antibody-Oligo Conjugate
SKU: aoc1899
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DMT1 Antibody-IF1
Antibody Target
- Target
- Natural resistance-associated macrophage protein 2
- UniProt Number
- P49281
- Target Description
- Proton-coupled metal ion symporter operating with a proton to metal ion stoichiometry of 1:1. Selectively transports various divalent metal cations, in decreasing affinity: Cd(2+) > Fe(2+) > Co(2+), Mn(2+) >> Zn(2+), Ni(2+), VO(2+). Essential for maintenance of iron homeostasis by modulating intestinal absorption of dietary Fe(2+) and TF-associated endosomal Fe(2+) transport in erythroid precursors and other cells. Enables Fe(2+) and Mn(2+) ion entry into mitochondria, and is thus expected to promote mitochondrial heme synthesis, iron-sulfur cluster biogenesis and antioxidant defense. Can mediate uncoupled fluxes of either protons or metal ions.
- Molecular Weight
- 61KDa/62KDa/64KDa/65KDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC59972
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse