Antibodies
Anti-DNA PKcs Antibody-Oligo Conjugate
SKU: aoc1903
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DNA PKcs Antibody-IF1
Antibody Target
- Target
- DNA-dependent protein kinase catalytic subunit
- UniProt Number
- P78527
- Target Description
- Serine/threonine-protein kinase that acts as a molecular sensor for DNA damage (PubMed:11955432, PubMed:12649176, PubMed:14734805, PubMed:33854234). Involved in DNA non-homologous end joining (NHEJ) required for double-strand break (DSB) repair and V(D)J recombination (PubMed:11955432, PubMed:12649176, PubMed:14734805, PubMed:33854234, PubMed:34352203). Must be bound to DNA to express its catalytic properties (PubMed:11955432). Promotes processing of hairpin DNA structures in V(D)J recombination by activation of the hairpin endonuclease artemis (DCLRE1C) (PubMed:11955432). Recruited by XRCC5 and XRCC6 to DNA ends and is required to (1) protect and align broken ends of DNA, thereby preventing their degradation, (2) and sequester the DSB for repair by NHEJ (PubMed:11955432, PubMed:12649176, PubMed:14734805, PubMed:15574326, PubMed:33854234). Acts as a scaffold protein to aid the localization of DNA repair proteins to the site of damage (PubMed:11955432, PubMed:12649176, PubMed:14734805, PubMed:15574326). The assembly of the DNA-PK complex at DNA ends is also required for the NHEJ ligation step (PubMed:11955432, PubMed:12649176, PubMed:14734805, PubMed:15574326). Found at the ends of chromosomes, suggesting a further role in the maintenance of telomeric stability and the prevention of chromosomal end fusion (By similarity). Also involved in modulation of transcription (PubMed:11955432, PubMed:12649176, PubMed:14734805, PubMed:15574326). As part of the DNA-PK complex, involved in the early steps of ribosome assembly by promoting the processing of precursor rRNA into mature 18S rRNA in the small-subunit processome (PubMed:32103174). Binding to U3 small nucleolar RNA, recruits PRKDC and XRCC5/Ku86 to the small-subunit processome (PubMed:32103174). Recognizes the substrate consensus sequence [ST]-Q (PubMed:11955432, PubMed:12649176, PubMed:14734805, PubMed:15574326). Phosphorylates 'Ser-139' of histone variant H2AX, thereby regulating DNA damage response mechanism (PubMed:14627815, PubMed:16046194). Phosphorylates ASF1A, DCLRE1C, c-Abl/ABL1, histone H1, HSPCA, c-jun/JUN, p53/TP53, PARP1, POU2F1, DHX9, FH, SRF, NHEJ1/XLF, XRCC1, XRCC4, XRCC5, XRCC6, WRN, MYC and RFA2 (PubMed:10026262, PubMed:10467406, PubMed:11889123, PubMed:12509254, PubMed:14599745, PubMed:14612514, PubMed:14704337, PubMed:15177042, PubMed:1597196, PubMed:16397295, PubMed:18644470, PubMed:2247066, PubMed:2507541, PubMed:26237645, PubMed:26666690, PubMed:28712728, PubMed:29478807, PubMed:30247612, PubMed:8407951, PubMed:8464713, PubMed:9139719, PubMed:9362500). Can phosphorylate C1D not only in the presence of linear DNA but also in the presence of supercoiled DNA (PubMed:9679063). Ability to phosphorylate p53/TP53 in the presence of supercoiled DNA is dependent on C1D (PubMed:9363941). Acts as a regulator of the phosphatidylinositol 3-kinase/protein kinase B signal transduction by mediating phosphorylation of 'Ser-473' of protein kinase B (PKB/AKT1, PKB/AKT2, PKB/AKT3), promoting their activation (PubMed:15262962). Contributes to the determination of the circadian period length by antagonizing phosphorylation of CRY1 'Ser-588' and increasing CRY1 protein stability, most likely through an indirect mechanism (By similarity). Plays a role in the regulation of DNA virus-mediated innate immune response by assembling into the HDP-RNP complex, a complex that serves as a platform for IRF3 phosphorylation and subsequent innate immune response activation through the cGAS-STING pathway (PubMed:28712728). Also regulates the cGAS-STING pathway by catalyzing phosphorylation of CGAS, thereby impairing CGAS oligomerization and activation (PubMed:33273464). Also regulates the cGAS-STING pathway by mediating phosphorylation of PARP1 (PubMed:35460603)..
- Molecular Weight
- 469 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPICCIHCELISA
- Clone
- ARC51265
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human