Antibodies
Anti-DNA Polymerase beta Antibody-Oligo Conjugate
SKU: aoc1904
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DNA Polymerase beta Antibody-IF1
Antibody Target
- Target
- DNA polymerase beta
- UniProt Number
- P06746
- Target Description
- Repair polymerase that plays a key role in base-excision repair. During this process, the damaged base is excised by specific DNA glycosylases, the DNA backbone is nicked at the abasic site by an apurinic/apyrimidic (AP) endonuclease, and POLB removes 5'-deoxyribose-phosphate from the preincised AP site acting as a 5'-deoxyribose-phosphate lyase (5'-dRP lyase); through its DNA polymerase activity, it adds one nucleotide to the 3' end of the arising single-nucleotide gap. Conducts 'gap-filling' DNA synthesis in a stepwise distributive fashion rather than in a processive fashion as for other DNA polymerases. It is also able to cleave sugar-phosphate bonds 3' to an intact AP site, acting as an AP lyase.
- Molecular Weight
- 38kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0752
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat