Antibodies
Anti-DNAJC15 Antibody-Oligo Conjugate
SKU: aoc1909
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DNAJC15 Antibody-IF1
Antibody Target
- Target
- DnaJ homolog subfamily C member 15
- UniProt Number
- Q9Y5T4
- Target Description
- Negative regulator of the mitochondrial respiratory chain. Prevents mitochondrial hyperpolarization state and restricts mitochondrial generation of ATP. Acts as an import component of the TIM23 translocase complex. Stimulates the ATPase activity of HSPA9.
- Molecular Weight
- 16kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0249
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat