Antibodies
Anti-Dopamine Transporter/DAT Antibody-Oligo Conjugate
SKU: aoc1916
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Dopamine Transporter/DAT Antibody-IF1
Antibody Target
- Target
- Sodium-dependent dopamine transporter
- UniProt Number
- Q01959
- Target Description
- Mediates sodium- and chloride-dependent transport of dopamine (PubMed:10375632, PubMed:11093780, PubMed:1406597, PubMed:15505207, PubMed:19478460, PubMed:39112701, PubMed:39112703, PubMed:39112705, PubMed:8302271). Also mediates sodium- and chloride-dependent transport of norepinephrine (also known as noradrenaline) (By similarity). Regulator of light-dependent retinal hyaloid vessel regression, downstream of OPN5 signaling (By similarity)..
- Molecular Weight
- 68kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC66721
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- A synthetic peptide corresponding to a sequence within amino acids 1-100 of human Dopamine Transporter/DAT (NP_001035.1).
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- MouseRat