Antibodies
Anti-DP1/TFDP1 Antibody-Oligo Conjugate
SKU: aoc1918
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DP1/TFDP1 Antibody-IF1
Antibody Target
- Target
- Transcription factor Dp-1
- UniProt Number
- Q14186
- Target Description
- Can stimulate E2F-dependent transcription. Binds DNA cooperatively with E2F family members through the E2 recognition site, 5'-TTTC[CG]CGC-3', found in the promoter region of a number of genes whose products are involved in cell cycle regulation or in DNA replication. The E2F1:DP complex appears to mediate both cell proliferation and apoptosis. Blocks adipocyte differentiation by repressing CEBPA binding to its target gene promoters.
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1202
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat