Antibodies
Anti-Drosha Antibody-Oligo Conjugate
SKU: aoc1922
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Drosha Antibody-IF1
Antibody Target
- Target
- Ribonuclease 3
- UniProt Number
- Q9NRR4
- Target Description
- Ribonuclease III double-stranded (ds) RNA-specific endoribonuclease that is involved in the initial step of microRNA (miRNA) biogenesis. Component of the microprocessor complex that is required to process primary miRNA transcripts (pri-miRNAs) to release precursor miRNA (pre-miRNA) in the nucleus. Within the microprocessor complex, DROSHA cleaves the 3' and 5' strands of a stem-loop in pri-miRNAs (processing center 11 bp from the dsRNA-ssRNA junction) to release hairpin-shaped pre-miRNAs that are subsequently cut by the cytoplasmic DICER to generate mature miRNAs. Involved also in pre-rRNA processing. Cleaves double-strand RNA and does not cleave single-strand RNA. Involved in the formation of GW bodies. Plays a role in growth homeostasis in response to autophagy in motor neurons (By similarity)..
- Molecular Weight
- 159kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0077
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human