Antibodies
Anti-DTYMK Antibody-Oligo Conjugate
SKU: aoc1923
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DTYMK Antibody-IF1
Antibody Target
- Target
- Thymidylate kinase
- UniProt Number
- P23919
- Target Description
- Catalyzes the phosphorylation of thymidine monophosphate (dTMP) to thymidine diphosphate (dTDP), the immediate precursor for the DNA building block dTTP, with ATP as the preferred phosphoryl donor in the presence of Mg(2+)..
- Molecular Weight
- 24kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2896
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human