Antibodies
Anti-DUSP6 Antibody-Oligo Conjugate
SKU: aoc1924
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DUSP6 Antibody-IF1
Antibody Target
- Target
- Dual specificity protein phosphatase 6
- UniProt Number
- Q16828
- Target Description
- Dual specificity protein phosphatase, which mediates dephosphorylation and inactivation of MAP kinases (PubMed:8670865). Has a specificity for the ERK family (PubMed:8670865). Plays an important role in alleviating chronic postoperative pain (By similarity). Necessary for the normal dephosphorylation of the long-lasting phosphorylated forms of spinal MAPK1/3 and MAP kinase p38 induced by peripheral surgery, which drives the resolution of acute postoperative allodynia (By similarity). Also important for dephosphorylation of MAPK1/3 in local wound tissue, which further contributes to resolution of acute pain (By similarity). Promotes cell differentiation by regulating MAPK1/MAPK3 activity and regulating the expression of AP1 transcription factors (PubMed:29043977)..
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIHCELISA
- Clone
- ARC0237
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat