Antibodies
Anti-DYNLL1 Antibody-Oligo Conjugate
SKU: aoc1928
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-DYNLL1 Antibody-IF1
Antibody Target
- Target
- Dynein light chain 1, cytoplasmic
- UniProt Number
- P63167
- Target Description
- Acts as one of several non-catalytic accessory components of the cytoplasmic dynein 1 complex that are thought to be involved in linking dynein to cargos and to adapter proteins that regulate dynein function. Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. May play a role in changing or maintaining the spatial distribution of cytoskeletal structures. In addition to its role in cytoskeleton and transport, acts as a protein-protein adapter, which inhibits and/or sequesters target proteins. Involved in the response to DNA damage by acting as a key regulator of DNA end resection: when phosphorylated at Ser-88, recruited to DNA double-strand breaks (DSBs) by TP53BP1 and acts by disrupting MRE11 dimerization, thereby inhibiting DNA end resection. In a subset of DSBs, DYNLL1 remains unphosphorylated and promotes the recruitment of the Shieldin complex. Binds and inhibits the catalytic activity of neuronal nitric oxide synthase/NOS1. Promotes transactivation functions of ESR1 and plays a role in the nuclear localization of ESR1. Regulates apoptotic activities of BCL2L11 by sequestering it to microtubules. Upon apoptotic stimuli the BCL2L11-DYNLL1 complex dissociates from cytoplasmic dynein and translocates to mitochondria and sequesters BCL2 thus neutralizing its antiapoptotic activity.
- Molecular Weight
- 10kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0975
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat