Antibodies
Anti-E2F6 Antibody-Oligo Conjugate
SKU: aoc1933
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-E2F6 Antibody-PLA1
Antibody Target
- Target
- Transcription factor E2F6
- UniProt Number
- O75461
- Target Description
- Inhibitor of E2F-dependent transcription (PubMed:9501179, PubMed:9689056, PubMed:9704927). Binds DNA cooperatively with DP proteins through the E2 recognition site, 5'-TTTC[CG]CGC-3' (PubMed:9501179). Has a preference for the 5'-TTTCCCGC-3' E2F recognition site (PubMed:9501179). E2F6 lacks the transcriptional activation and pocket protein binding domains (PubMed:9501179, PubMed:9704927). Appears to regulate a subset of E2F-dependent genes whose products are required for entry into the cell cycle but not for normal cell cycle progression (PubMed:9501179, PubMed:9689056). Represses expression of some meiosis-specific genes, including SLC25A31/ANT4 (By similarity). May silence expression via the recruitment of a chromatin remodeling complex containing histone H3-K9 methyltransferase activity. Overexpression delays the exit of cells from the S-phase (PubMed:9501179)..
- Molecular Weight
- 32kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBChIPCUT&TagELISA
- Clone
- ARC0628
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human