Antibodies
Anti-EAAT1 Antibody-Oligo Conjugate
SKU: aoc1934
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-EAAT1 Antibody-IF1
Antibody Target
- Target
- Excitatory amino acid transporter 1
- UniProt Number
- P43003
- Target Description
- Sodium-dependent, high-affinity amino acid transporter that mediates the uptake of L-glutamate and also L-aspartate and D-aspartate (PubMed:20477940, PubMed:26690923, PubMed:28032905, PubMed:28424515, PubMed:7521911, PubMed:8123008). Functions as a symporter that transports one amino acid molecule together with two or three Na(+) ions and one proton, in parallel with the counter-transport of one K(+) ion (PubMed:20477940). Mediates Cl(-) flux that is not coupled to amino acid transport; this avoids the accumulation of negative charges due to aspartate and Na(+) symport (PubMed:20477940). Plays a redundant role in the rapid removal of released glutamate from the synaptic cleft, which is essential for terminating the postsynaptic action of glutamate (By similarity)..
- Molecular Weight
- 60kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC1714
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- MouseRat