Antibodies
Anti-EB3 Antibody-Oligo Conjugate
SKU: aoc1936
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-EB3 Antibody-IF1
Antibody Target
- Target
- Microtubule-associated protein RP/EB family member 3
- UniProt Number
- Q9UPY8
- Target Description
- Plus-end tracking protein (+TIP) that binds to the plus-end of microtubules and regulates the dynamics of the microtubule cytoskeleton. Promotes microtubule growth. May be involved in spindle function by stabilizing microtubules and anchoring them at centrosomes. Also acts as a regulator of minus-end microtubule organization: interacts with the complex formed by AKAP9 and PDE4DIP, leading to recruit CAMSAP2 to the Golgi apparatus, thereby tethering non-centrosomal minus-end microtubules to the Golgi, an important step for polarized cell movement. Promotes elongation of CAMSAP2-decorated microtubule stretches on the minus-end of microtubules.
- Molecular Weight
- 32kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2305
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat