Antibodies
Anti-EB3 Antibody-Oligo Conjugate
SKU: aoc1936
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-EB3 Antibody-IF1
Antibody Target
- Target
- Microtubule-associated protein RP/EB family member 3
- UniProt Number
- Q9UPY8
- Target Description
- Plus-end tracking protein (+TIP) that binds to the plus-end of microtubules and regulates the dynamics of the microtubule cytoskeleton (PubMed:19255245, PubMed:28814570). Promotes microtubule growth (PubMed:19255245, PubMed:28814570). May be involved in spindle function by stabilizing microtubules and anchoring them at centrosomes (PubMed:19255245, PubMed:28814570). Also acts as a regulator of minus-end microtubule organization: interacts with the complex formed by AKAP9 and PDE4DIP, leading to recruit CAMSAP2 to the Golgi apparatus, thereby tethering non-centrosomal minus-end microtubules to the Golgi, an important step for polarized cell movement (PubMed:28814570). Promotes elongation of CAMSAP2-decorated microtubule stretches on the minus-end of microtubules (PubMed:28814570)..
- Molecular Weight
- 32kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2305
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat